The Journal of Bone and Joint Surgery 81:225-238 (1999)
© 1999 The Journal of Bone and Joint Surgery, Inc.
Ehlers-Danlos Syndrome Type VII: Clinical Features and Molecular Defects*
CECILIA GIUNTA, PH.D. ,
ANDREA SUPERTI-FURGA, M.D. , ZURICH,
STEPHANIE SPRANGER, M.D. , HEIDELBERG, GERMANY,
WILLIAM G. COLE, PH.D., F.R.C.S.(C)§, TORONTO, ONTARIO, CANADA and
BEAT STEINMANN, M.D. , ZURICH, SWITZERLAND
Investigation performed at the Department of Metabolic and Molecular Diseases, University Children's Hospital, Zurich University, Zurich
 |
Abstract
|
|---|
We evaluated the clinical features, molecular defects, and problems associated with the management of two patients who had type-VII Ehlers-Danlos syndrome and reviewed the cases of eighteen patients with this condition who had been reported on previously. The typical clinical features associated with this syndrome include bilateral congenital dislocation of the hip; severe generalized hypermobility of the joints; multiple dislocations of joints other than the hip; muscular hypotonia; and hyperelasticity, fragility, and a doughy texture of the skin.
Collagen and DNA analyses demonstrated that both of our patients had type-VIIB Ehlers-Danlos syndrome, which is caused by heterozygous new mutations of the COL1A2 gene that encodes the pro 2(I) chain of type-I procollagen. The obligatory GT dinucleotide at the splice donor site of intron 6 was altered in both of our patients: one patient (Case 1) had an A substitution of the G nucleotide, and the other patient (Case 2) had a C substitution of the T nucleotide. Abnormal splicing resulted in the loss of the exon 6-encoded N-telopeptide, which includes the N-proteinase cleavage site.
Despite multiple operative procedures, one of our patients, who was thirty-seven years old at the time of the most recent follow-up, continued to have persistent subluxation of the right hip and osteoarthritis of the left hip. Closed reduction of the dislocated hips, regardless of the type of immobilization used, was unsuccessful in all twenty patients. The results of open reduction were improved when capsulorrhaphy was combined with iliac or femoral osteotomy, or both.
 |
Introduction
|
|---|
Ehlers-Danlos syndrome is a genetically and clinically heterogeneous group of inherited connective-tissue disorders characterized by hypermobility of the joints as well as hyperextensibility and fragility of the skin. Variable expression of these features, different modes of inheritance, and distinctive associated manifestations distinguish the ten types of the syndrome13,36. Hass and Hass16, in what appears to have been the first such report in the English-language literature, described the cases of five children who had generalized and severe joint laxity; those authors termed the condition arthrochalasis multiplex congenita. At birth, the patients had excessive hypermobility of the joints (often manifested as dislocations of the hips and knees) and severe muscular hypotonia. The skin was soft, hyperelastic, and fragile, but less severely so than that of patients who have type-I Ehlers-Danlos syndrome, which is the classic form of the disorder3. The outcome of treatment of the dislocated hips was unsatisfactory because of the difficulties of maintaining the reduction without several operative procedures and because of the early onset of osteoarthritis.
The clinical features of type-VII Ehlers-Danlos syndrome are inevitable given the underlying molecular defect, which is characterized by abnormal processing of type-I procollagen to type-I collagen. Normally, each molecule of type-I procollagen contains two pro 1(I) chains and one pro 2(I) chain. After secretion from cells such as fibroblasts, the amino-propeptide and carboxyl-propeptide extensions are removed by the N-proteinase and C-proteinase enzymes, respectively, to produce type-I collagen. This form of collagen is the principal component of the thick collagen fibrils that are found in ligaments, tendons, dermis, bone, and dentin.
Three types of processing defects of the amino propeptide have been identified. In type-VIIA Ehlers-Danlos syndrome, autosomal dominant mutations of the COL1A1 gene result in skipping of the exon 6-encoded sequences so that the mutant pro 1(I) chains lack the N-proteinase cleavage site. Consequently, the cells produce a form of type-I collagen that contains normally cleavable 1(I) chains as well as 1(I) chains that remain uncleaved (referred to as pN 1[I]-like chains). Similarly, in type-VIIB disease, autosomal dominant mutations of the COL1A2 gene result in skipping of exon 6 or genomic deletion of exon 6 with loss of the N-proteinase cleavage site and the presence of abnormally processed 2(I) chains (referred to as pN 2[I]-like chains). In type-VIIC disease, autosomal recessive mutations of the gene encoding the N-proteinase enzyme impair the cleavage of the pro 1(I) and pro 2(I) chains.
In this review, we will focus on the musculoskeletal features and molecular defects associated with type-VIIA and VIIB Ehlers-Danlos syndrome as these two forms of the disorder are clinically indistinguishable. Eighteen of the twenty patients in the present study were described in previous reports.
 |
Materials and Methods
|
|---|
Cell Cultures and Collagen Analysis
Collagen was extracted from a small piece of skin that had been obtained from one of our patients (Case 2). The skin was finely minced and was stored overnight, at 4 degrees Celsius, in one milligram per milliliter of pepsin in 0.5-molar acetic acid. The solution was neutralized with 1-N sodium hydroxide, and the sample was analyzed by 5 percent sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis. The gel was stained with 0.2 percent Coomassie brilliant blue R-250 and was photographed34.
Dermal fibroblasts, obtained from skin-biopsy specimens from our two patients, were grown in tissue-culture medium and labeled with radioactive amino acids34. At the end of the incubation period, the medium and cell layers were collected separately. Collagen samples were digested with pepsin, precipitated with ethanol, and analyzed by 5 percent sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis. The stability of the collagen to increasing temperature was tested5. Cyanogen bromide peptides were generated by cyanogen bromide cleavage of collagen and analyzed by second-dimensional gel electrophoresis. The fibroblasts produced unhydroxylated collagen in the presence of , '-dipyridyl34.
cDNA Analysis
Total RNA was isolated from cultured dermal fibroblasts with use of Trizol reagent (Gibco BRL Life Technologies, Gaithersburg, Maryland), with minor modifications in the recommended methodology. cDNA was generated by reverse transcription29 with use of AMV (avian myoblastosis virus) reverse transcriptase (Roche Molecular Biochemicals, Mannheim, Germany) and random hexamers as primers. For amplification with use of the polymerase chain-reaction technique, the 5' forward and 3' reverse primers were designed according to the published sequence12. Polymerase chain-reaction products were gel purified and extracted with a gel-purification kit (Qiaex II; Qiagen, Hilden, Germany) as described by the manufacturer. Dideoxy sequencing of the double-stranded DNA from patients and controls was done in the presence of NP-40 with use of the T7 sequenase kit (United States Biochemical, Cleveland, Ohio)1.
Genomic DNA Analysis
Genomic DNA was isolated from peripheral blood leukocytes or confluent cultured fibroblasts. Three hundred nanograms of genomic DNA served as a template for polymerase chain-reaction amplification of a 358-base-pair fragment between intron 5 and intron 6 of the COL1A2 gene. Sequencing of double-stranded polymerase chain-reaction products from patients and controls was performed as described previously1.
Characterization of Alleles
Alleles were characterized with use of the Amplification Refractory Mutation System (ARMS) and direct sequencing. The Amplification Refractory Mutation System was used to assess the cosegregation of each splicing mutation with a conservative change (T-to-C), found in both patients, in the seventh codon (aspartic acid) of exon 6. The polymerase chain-reaction primers were designed according to previously reported data12, and they included a 28mer 3' reverse primer (N0 = CTAAGTATTGAGTGTTAACTTAGGTAGC), a 29mer 5' primer specific for the Asp82 GAT codon and containing a mismatch near the 3' end (A1 = TTCTCTAGAACTTTGCTGCTTCAGTATAT), and a 29mer 5' primer specific for the Asp82 GAC codon containing an additional mismatch near the 3' end (A2 = TTCTCTAGAACTTTGCTGCTTCAGTATAC). Polymerase chain-reaction products were subjected to electrophoresis on a 2 percent NuSieve/1 percent agarose gel (FMC Bioproducts, Rockville, Maryland) and were visualized by ethidium bromide staining. Direct sequencing of the polymerase chain-reaction products was performed as described previously1.
 |
Case Reports
|
|---|
CASE 1. The diagnosis of type-VII Ehlers-Danlos syndrome was made, by Dr. Katarina Raslova (Bratislava, Slovakia), when the patient was thirty-three years old. The patient had been delivered in the breech position and had congenital dislocation of both hips and the left knee. His father and mother were twenty-six and twenty-three years old, respectively, at the time of his birth. Both parents were clinically normal. There was no history of consanguinity. His two younger brothers had no evidence of the disease. The patient's motor development was delayed secondary to marked muscular hypotonia as well as generalized hypermobility and instability of the joints. The patient also had an umbilical hernia.
Bilateral open reduction of the hip was performed when the patient was two years old. He began to sit and to stand with support when he was three years old. Instability of the left knee interfered with his ability to walk independently, and he continued to crawl until he was nine years old. At that time, the posterior part of the capsule of the left knee was operatively tightened; subsequently, the knee was more stable and the patient was able to walk without support. An arthrodesis of the right ankle also was performed to control instability. The skin was fragile, but wound-healing was not delayed. A urinary tract infection developed when the patient was seventeen years old. At that time, the patient was found to have a bladder diverticulum, which was resected.
At the time that the diagnosis was confirmed biochemically, the patient demonstrated the typical features of type-VII Ehlers-Danlos syndrome. The skin was thin, soft, and hyperelastic, and it was redundant over the fingers. There was brownish discoloration over the tibiae, knees, and elbows as well as moderate sagging of the facial skin. The shoulder joints were subluxated inferiorly, and the radial heads were dislocated posteriorly. The wrist, distal radioulnar, and finger joints were extremely hypermobile; the metacarpophalangeal joints of the second through fifth digits were deviated ulnarly; and there were swan-neck deformities of the fingers secondary to laxity of the volar plates of the proximal interphalangeal joints.
On the right side, the ankle had fused in a position of equinovarus, the foot had a cavus deformity, the metatarsophalangeal joints of the fourth and fifth toes were dislocated, and there was a hallux valgus deformity. On the left side, the ankle was in equinus, the foot had a severe planovalgus deformity, there was a severe hallux valgus deformity, and there were swan-neck deformities of the second through fifth toes, which were deviated laterally.
Both knees were hypermobile in all directions. The pelvis was elevated on the right side because of the fixed equinus deformity of the right ankle. The right hip was subluxated and the acetabulum was dysplastic, with sclerosis of its outer third and rounding of its margin (Fig. 1). The articular surface of the femoral head was irregular, and there was evidence of avascular necrosis. An osseous fragment was observed superior to the femoral head. The joint space of the left hip was decreased, and the femoral head demonstrated findings that were suggestive of avascular necrosis. The patient had a left thoracolumbar scoliosis. Examination of the other systems revealed normal findings.

View larger version (115K):
[in this window]
[in a new window]
|
FIG1: Fig. 1 Case 1. Anteroposterior radiograph of the pelvis and hips, made with the patient standing; the patient was thirty-four years old at the time that this radiograph was made. On the right side, Shenton's line was broken, the teardrop was enlarged, the acetabulum was shallow and sclerotic along its outer third, the femoral head was irregular, and there was a bone fragment in the superior segment of the hip joint. On the left side, Shenton's line was intact, the femoral head was irregular, the joint space was narrow, and the acetabulum appeared to be normal.
|
|
The patient had an unaffected child from his first marriage. After the patient was diagnosed with Ehlers-Danlos syndrome, he requested prenatal testing of his pregnant wife. The fetus was deemed to be unaffected because of the absence of pN 2(I)-like chains in collagen extracted from short-term cultures of the chorionic villi28. His wife delivered a healthy baby girl.
CASE 2. The patient was born to healthy parents, of German origin, who were not related. His father and mother were thirty-seven and thirty-one years old, respectively, at the time of his birth. The patient was delivered in the vertex position. His two siblings were normal. There was no family history of Ehlers-Danlos syndrome, although there was a paternal family history of large heads and funnel-chest deformities and a maternal family history of large heads. At the time of birth, the patient weighed 4100 grams (ninetieth percentile) and was fifty-five centimeters long (1.5 centimeters greater than the ninetieth percentile); the circumference of the head was forty centimeters (three centimeters greater than the ninety-seventh percentile).
At the time of birth, the patient had generalized hypotonia; dislocation of the hips, shoulders, temporomandibular joints, thumbs, and great toes; instability of the remaining joints; pectus excavatum; and macrocephaly with large anterior and posterior fontanelles (four by six centimeters and three by two centimeters, respectively). Dislocation of the hips and acetabular dysplasia were confirmed with ultrasonography. The dislocations were treated with abduction orthoses for four months. Ultrasonography of the brain revealed normal findings. A velvety, hyperelastic quality of the skin was first noted when the patient was nine months old.
At eighteen months, gross motor development was still delayed secondary to hypotonia (Fig. 2-A). The circumference of the head was fifty-five centimeters (four centimeters greater than the ninety-seventh percentile), and the anterior fontanelle was still open. The skin was hyperelastic and doughy and it bruised easily; however, there was no evidence of abnormal scar formation. The patient had marked generalized joint laxity (Fig. 2-B) and moderate pectus excavatum. Poor muscle control of the trunk and limbs as well as hypermobility of the joints, particularly the knees, prevented the patient from standing without assistance; as a result, the patient moved from one point to another by scooting forward on his buttocks. The internal organs and the central nervous system were clinically normal. Lateral radiographs of the knees showed posterior subluxation of the tibia on the femur (Fig. 2-C), an anteroposterior radiograph of the pelvis showed bilateral subluxation of the hip (Fig. 2-D), and radiographs of the skull showed wormian bones (Fig. 2-E).

View larger version (138K):
[in this window]
[in a new window]
|
FIG2-A: Figs. 2-A through 2-E: Case 2. Clinical photographs and radiographs made when the patient was eighteen months old.
Fig. 2-A: Photograph showing the inability of the child to maintain an upright posture because of marked hypotonia as well as hypermobility of the joints.
|
|

View larger version (82K):
[in this window]
[in a new window]
|
FIG2-C: Fig. 2-C Lateral radiograph of the knee, showing posterior subluxation of the tibia on the femur.
|
|

View larger version (137K):
[in this window]
[in a new window]
|
FIG2-E: Fig. 2-E Lateral radiograph of the skull, showing wormian bones (arrow) near the occipital suture, a large open anterior fontanelle, and thickening of the calvaria, which had a pumice-like appearance.
|
|
 |
Biochemical and Molecular Results
|
|---|
Electrophoresis of the pepsin-extracted dermal collagen obtained from one of our patients (Case 2) showed an additional band migrating between the 1(I) and 2(I) chains of type-I collagen and resembling the mobility of pN 2(I) chains; this finding was consistent with type-VIIB disease and confirmed the clinical diagnosis. Similarly, electrophoresis of pepsin-digested collagen produced by cultured dermal fibroblasts from both patients demonstrated a pN 2(I)-like chain migrating between normal collagen (I) chains (Fig. 3). Two-dimensional cyanogen-bromide peptide mapping showed normal cyanogen-bromide peptides of the 1(I) and 2(I) chains and, in addition, a minor cyanogen-bromide peptide derived from the abnormal pN 2(I) chain, found in both patients, that migrated more slowly than did cyanogen bromide peptide 4 (CB4).
Abnormal type-I collagen molecules containing mutant pN 2(I)-like chains, secreted normally from both cell strains, had a melting temperature of 41.5 degrees Celsius, similar to that of normal type-I collagen molecules secreted from cells from the patients and the controls. Unhydroxylated collagens synthesized by fibroblasts in the presence of , '-dipyridyl were resolved by 5 percent sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis after folding of the triple helix at a low temperature and pepsin digestion. Under these conditions, the double 2(I) protein bands continued to confirm that the slower migrating band was a pN 2(I)-like chain rather than an overmodified 2(I) chain. Our findings were similar to those of previous studies of patients who had type-VIIB Ehlers-Danlos syndrome33,35.
The molecular defect that is associated with type-VIIB Ehlers-Danlos syndrome is remarkably homogeneous and results in partial or complete loss of exon 6 of the COL1A2 gene (Table I). In order to characterize the specific mutations in our two patients, a fragment of cDNA encoding exons 5 to 8 of the COL1A2 gene was amplified with specific primers and analyzed on an agarose gel. Reverse-transcription polymerase chain-reaction amplification of the total RNA from the controls produced a unique 124-base-pair fragment, whereas amplification of the RNA from both of our patients produced a normal 124-base-pair fragment and a shorter seventy-base-pair fragment. Sequencing of the shorter fragments showed that both patients lacked exon 6-encoded sequences. In one of these patients (Case 2) direct sequencing of a 358-base-pair fragment encompassing intron 5 to 6 of the COL1A2 gene revealed a T-to-C transition at the second position T+2 of the 5' splice site, which altered the obligatory GT nucleotide to GC, whereas in the other patient (Case 1) sequencing showed a G-to-A substitution at the first position G+1 of the 5' splice site (Table I). The T-to-C substitution in intron 6 of the first patient (Case 2), which disrupted the Sph I restriction-endonuclease recognition site (GCATG C), was confirmed by restriction-enzyme analysis of the 358-base-pair fragment.
Sequence analysis also showed, in both patients, a conservative T-to-C change that did not alter the aspartic acid codon at amino acid position 82 of the 2(I) chain, a polymorphism that has been reported previously12,19,37. The Amplification Refractory Mutation System (ARMS) was used to assess cosegregation of the polymorphism with the two mutations. Two separate polymerase chain reactions were carried out with use of the same 3' primer (N0) but with two different 5' primers (A1 and A2) on genomic DNA from both patients and from four additional individuals. The 3' ends of each 5' primer were designed to match either the GAT or the GAC aspartic acid codon at position 82. Primers N0 and A1 amplified only the T-containing allele, whereas primers N0 and A2 amplified the C-containing allele. Dideoxy sequencing of these products in both patients revealed that the polymorphic C-containing alleles, and not the regular T-containing alleles, carried the specific mutations (Fig. 4). Furthermore, studies of the parents indicated that the mutation in one patient (Case 2) occurred in the paternal C-containing allele. The mother of the other patient (Case 1) carried two regular T-containing alleles. The father could not be tested; however, we assumed that the mutation may have also occurred in the paternal allele with the C-polymorphism.

View larger version (40K):
[in this window]
[in a new window]
|
FIG4: Fig. 4 Images showing the nucleotide sequence of normal and mutant alleles obtained by Amplification Refractory Mutation System (ARMS) polymerase chain reaction. In one patient (Case 1), the C-containing allele, which was amplified with primers N0 and A2, shows the G-to-A substitution at the first position of the 5' splice site of intron 6 of the COL1A2 gene. In the other patient (Case 2), the C-containing allele shows the T-to-C substitution at the second position of the 5' splice site of the same intron. Both substitutions alter the obligatory GT nucleotide sequence at the 5' splice site. The exon 6 sequence is depicted in uppercase letters, and the intron 6 sequence is depicted in lowercase letters. The box encloses the obligatory GT dinucleotide.
|
|
 |
Discussion
|
|---|
Clinical Features
The classic clinical features of Ehlers-Danlos syndrome are present, to varying degrees, in each subtype of the condition. The cardinal feature of this syndrome is the hyperelasticity of the skin. The skin is often colorless and thin, and it sometimes has a doughy texture. Other features include cutaneous fragility, hematoma, and bruising as well as molluscoid pseudotumors and spheroids. The skeletal abnormalities include hyperextensibility, instability, and dislocations of the joints; effusions in the joints; and enlarged bursae over the olecranon and in the prepatellar region.
The classification of Ehlers-Danlos syndrome is based on the extent and severity of the classic clinical features and coexistent abnormalities, the most likely pattern of inheritance, and the results of biochemical and molecular analyses. The number of subtypes has gradually increased. The diagnosis of the subtypes often remains ambiguous because there is a phenotypic continuum and because the appearance of recognizable symptoms is time-dependent, particularly in children.
One of us (B. S.), in collaboration with four other investigators from departments of genetics from various parts of the world, has proposed a new, simplified, and more practical system of classification3. This system was described in the American Journal of Medical Genetics in 1998, and the authors stated that they hoped that these revised criteria would serve as a new, albeit provisional, standard for the clinical diagnosis of Ehlers-Danlos syndrome, for investigations of its genetic heterogeneity and phenotype-genotype correlations, and for clinical research on various aspects of the disorder.
The purposes of this new system were (1) to introduce diagnostic criteria based on the specificity of the various clinical manifestations of each type of the syndrome; (2) to formalize the use of laboratory findings, when possible, in the diagnostic definition of each type; and (3) to simplify the existing system of classification so that it can be used by the generalist. This new system includes six major types (referred to as the classic, hypermobility, vascular, kyphoscoliosis, arthrochalasia, and dermatosparaxis types), each of which has a pathognomonic manifestation. Furthermore, the molecular defect associated with each type either has been clearly defined or is being clarified further.
The authors of this new system suggested that hyperextensibility of the skin should be tested at a site that is not subject to mechanical forces or scarring and that hypermobility of the joints should be assessed with use of one of the clinical scores. Easy bruising is manifested as episodes of spontaneous ecchymosis, frequently recurring in the same areas, characterized by brownish discoloration. Tissue fragility is manifested as areas of easy bruising and dystrophic scars. Mitral valve prolapse and dilatation of the proximal part of the aorta should be assessed with use of echocardiography. Patients often report chronic pain in the joints and extremities, although radiographs usually reveal normal findings.
The classic type (types I and II) has an autosomal dominant pattern of inheritance and is characterized by hyperextensibility of the skin, signs of tissue fragility, and hypermobility of the joints. The minor clinical criteria include molluscoid pseudotumors, subcutaneous spheroids, complications related to hypermobility of the joints, muscular hypotonia, and easy bruising. Biochemical and molecular analyses have revealed defects in type-V collagen in several but not all families who have had the classic type of Ehlers-Danlos syndrome. In fact, considerable locus heterogeneity has been documented36.
The hypermobility type (type III) has an autosomal dominant pattern of inheritance and is characterized by hyperextensibility of the skin and generalized hypermobility of the joints. Other clinical manifestations include a positive family history, the absence of tissue fragility, recurrent dislocations, and chronic pain in the joints and extremities. In the clinical setting, children with hypermobility of joints are sometimes diagnosed as having Ehlers-Danlos syndrome.
The vascular type (type IV) is caused by structural defects in the pro 1(III) chain of type-III collagen encoded by the COL3A1 gene. The disorder has an autosomal dominant pattern of inheritance and is characterized by the presence of thin, translucent skin; fragility and even rupture of the arteries, intestines, and uterus; extensive bruising; and a characteristic facial appearance. The minor diagnostic criteria include hypermobility of the small joints, clubfoot deformity, rupture of the tendons and muscles, early-onset varicose veins, arteriovenous fistulae, pneumothorax, and a positive family history.
The kyphoscoliosis type (type VIA) is caused by a deficiency of lysyl hydroxylase, a collagen-modifying enzyme. Homozygosity or compound heterozygosity for one or more mutant alleles coding for the enzyme results in its deficiency. The disorder has an autosomal recessive pattern of inheritance and is characterized by generalized joint laxity, severe muscular hypotonia at birth, scoliosis at birth (with subsequent progression), fragility of the sclera, and rupture of the ocular globe. Other clinical features include easy bruising, tissue fragility, a marfanoid habitus, osteopenia, and often a positive family history. The recommended test is the measurement of total urinary hydroxylysyl pyridinoline (pyridinoline) and lysyl pyridinoline (deoxypyridinoline) cross-links after hydrolysis by high-performance liquid chromatography. This test is readily available and has a high degree of sensitivity and specificity.
The arthrochalasia type (types VIIA and VIIB) is caused by mutations leading to deficient processing of the aminoterminal end of the pro 1(I) (type VIIA) or pro 2(I) (type VIIB) chains of type-I collagen because of skipping of exon 6 in either gene. The disorder has an autosomal dominant pattern of inheritance and is characterized by severe generalized hypermobility and recurrent subluxation of the joints as well as bilateral congenital dislocation of the hip. Other clinical features include hyperextensibility of the skin, easy bruising, tissue fragility, hypotonia, kyphoscoliosis, and mild osteopenia. The biochemical defect is confirmed by electrophoretic demonstration of pN 1(I) or pN 2(I) chains extracted from dermal collagen or obtained from cultured dermal fibroblasts. Direct demonstration of complete or partial skipping of exon 6 in cDNAs of the COL1A1 or COL1A2 gene can be performed, followed by mutation analysis.
The dermatosparaxis type (type VIIC) is caused by a deficiency of type-I procollagen N-terminal peptidase that results from homozygosity of mutant alleles coding for this enzyme (in contrast to the arthrochalasia type, which is due to mutations involving the substrate sites of type-I procollagen chains). The disorder has an autosomal recessive pattern of inheritance and is characterized by severe skin fragility as well as the presence of sagging, redundant skin that is easily avulsed from the underlying tissues even after minor trauma. Biochemical confirmation is based on the electrophoretic demonstration of pN 1(I) and pN 2(I) chains from type-I collagen extracted from dermis in the presence of protease inhibitors or obtained from fibroblasts26,30.
The classic, hypermobility, and arterial types of the disorder are considerably more common than the kyphoscoliosis, arthrochalasia, and dermatosparaxis types.
The patients in this study were classified as having type-VII Ehlers-Danlos syndrome and appeared to demonstrate the characteristic features of the arthrochalasia type as described in the new proposed classification.
The clinical features of type-VII Ehlers-Danlos syndrome were present in both of our patients as well as in the eighteen patients who were described previously (Table I). In some instances only, the diagnosis was made in the newborn period. Fragility and bruising of the skin were less pronounced than in type-I Ehlers-Danlos syndrome, but excessive bleeding occurred intraoperatively in one patient (Case 4). The newly recognized occurrence of recurrent fractures in seven patients and wormian bones in three others, as well as the presence of large patent fontanelles, indicates that the bone changes and fragility seen in association with the type-VII phenotype are similar to those reported in association with mild osteogenesis imperfecta.
Orthopaedic Treatment
The principal orthopaedic problem in these patients is bilateral congenital dislocation of the hip. We reviewed the outcomes of treatment of this problem in sixteen individuals from twelve families (Table II). This group included twelve of the twenty patients who are listed in Table I; the remaining eight patients in Table I were not included because there was insufficient information in the published reports. Stable reduction rarely was maintained after closed reduction despite the use of an orthosis or a hip-spica cast. Anterolateral open reduction with capsular plication, even in infancy, also was unsuccessful as most patients continued to have subluxation or dislocation of the hip. The poor outcomes most likely were due to early stretching at the site of the capsulorrhaphy. The addition of a Pemberton or Salter-type iliac osteotomy, with or without a femoral osteotomy, was associated with good results in three patients (Cases 14, 15, and 20). The need for an osteotomy to achieve and maintain stable reduction of the hip has been reported in association with other laxity syndromes such as Down syndrome and Larsen syndrome4,31.
Generalized hypermobility of the joints, as was seen in one of our patients (Case 2), is worse in infancy when marked muscular hypotonia accompanies the severe ligamentous laxity. Consequently, motor development is slow and various types of orthoses are necessary to stabilize the joints of the lower extremity when the patient attempts to stand and to walk. As muscle tone improves, knee-ankle-foot orthoses can be converted to ankle-foot orthoses. There are few reports on procedures designed to stabilize the knee and patellofemoral joints because stability is better maintained with use of orthoses. Arthrodesis of the ankle or the subtalar joint is rarely performed; however, when arthrodesis is performed, it is essential that the ankle and foot be placed in the most functional position.
Recurrent or persistent dislocation of various joints as well as hypermobility of the joints of the upper extremity often interferes with function, as was noted in our two patients. Operative procedures involving the upper extremity rarely were performed. We do not believe that capsulorraphies and osteotomies will stabilize such joints. Arthrodesis of the joints of the hand, such as the metacarpophalangeal joint of the thumb, may be helpful; however, it is difficult to predict the rate of fusion. Therefore, we recommend that efforts be directed toward the use of assistive devices and splints as well as toward the use of occupational therapy focusing on the achievement of independence in activities of daily living.
Postural thoracolumbar kyphosis due to hypotonia and ligamentous laxity sometimes is seen in infancy, as was the case for one of our patients (Case 2). The spinal posture typically improves as the child gains muscular power. Structural scoliosis was noted in one of our patients (Case 1) as well as in seven of the patients who were described previously (Cases 4, 5, 8, 9, 17, 19, and 20). Spinal arthrodesis was performed for two patients (Cases 8 and 9), although few details were provided concerning the curve patterns and the operative findings. Spondylolisthesis of the fifth lumbar on the first sacral vertebra was noted in one patient (Case 17).
McMaster23 reported on the treatment of scoliosis in five patients who had Ehlers-Danlos syndrome. Although at least two of the patients were found to have type-VI disease, which is a different form of the syndrome than was observed in our patients, that report highlighted the problems associated with the treatment of scoliosis in this particular population. The scoliosis was recognized before the age of four years in all five patients. The author noted that the curves could not be controlled with a brace and that they progressed rapidly during the adolescent growth spurt.
Molecular Features
The molecular defect that was common to all twenty patients who had type-VII Ehlers-Danlos syndrome was the loss of all or part of exon 6 of the COL1A1 or COL1A2 mRNA coding for the pro 1(I) or pro 2(I) chain. Heterozygous point mutations led to skipping of this exon during the processing of pre-mRNA to mRNA. In the present study, heterozygous point mutations at the highly conserved GT dinucleotide of the splice donor site of intron 6 of the COL1A2 gene were shown to cause the loss of all of exon 6. One of our patients (Case 1) was heterozygous for a G-to-A transition, a mutation found in six of the seventeen patients who had type-VIIB syndrome, whereas the other patient (Case 2) was heterozygous for a T-to-C transition, a mutation found in three of these seventeen patients (Table I).
Single base substitutions altering the highly conserved GT dinucleotide of the splice donor site of intron 6 of the COL1A2 gene led to exon skipping in eleven of the seventeen patients who had type-VIIB disease. The other six defects in that group included partial deletion of exon 6 (Case 17), base substitutions at the highly conserved AG dinucleotide of the splice acceptor site (Cases 3, 4, and 5), and a G-to-A change at the last nucleotide of exon 6 (Cases 6 and 7). The G-to-C change at the splice acceptor site of intron 5 (Case 5) activated a cryptic AG splice site at positions +14 and +15 of exon 6, causing the deletion of five amino acid residues, including the N-proteinase cleavage site (Table I). The G-to-A change at the last nucleotide of exon 6 of the COL1A2 gene of one patient (Case 6) produced temperature-dependent alternative splicing of exon 6. When the fibroblasts from this patient were grown at 31 degrees Celsius, only correctly spliced products were obtained, whereas at 39 degrees Celsius normal and abnormally spliced products were obtained in a 1:1 ratio43. Similar temperature-dependent alternative splicing was observed in one patient (Case 19) because of a similar mutation of the COL1A1 gene (Table I).
In type-VIIB Ehlers-Danlos syndrome, the heterotrimeric type-I collagen molecules consist of one population of normal type-I collagen and one population of abnormal type-I collagen containing the mutant 2(I) chain. In contrast, in type-VIIA disease, three-fourths of the type-I collagen molecules are expected to be abnormal because they contain one or two mutant 1(I) chains; thus, the type-VIIA phenotype is expected to be more severe than the type-VIIB phenotype. However, two of the three patients who had type-VIIA disease had substitutions for the last nucleotide of exon 6 (Table I). These substitutions result in alternative splicing, so that part of the product deletes the exon sequence from mRNA, whereas the remainder permits normal splicing, and the protein product contains isoleucine rather than methionine at position 3 of the first glycine-X-Y triplet of the triple helix. Even though it contains an amino acid substitution, the normally spliced product decreases the effect of the abnormal molecules. If less than three-fourths of the type-I collagen is abnormal, the result will be a less severe clinical phenotype that is indistinguishable from type-VIIB disease. In contrast, in one patient (Case 18) the complete loss of exon 6 from mutant pro 1(I) chains led to three-fourths of the type-I collagen molecules being abnormal and dysfunctional6. This explains the more severe phenotype almost resembling type-VIIC disease in which all type-I collagen molecules are abnormal26,30.
Complete loss of the sequence encoded by exon 6 of the COL1A1 and COL1A2 genes deletes the N-telopeptide, a small sequence (twenty-four and eighteen amino acids, respectively) that links the N-propeptide to the major triple-helical domain of the pro 1(I) and pro 2(I) chain. The N-telopeptide includes the N-proteinase cleavage site (Pro-Glu and Ala-Glu at positions 4 and 5, respectively), the lysine cross-linking site (at positions 13 and 9, respectively), and the first amino acid triplet of the main glycine-X-Y triple helical domain (Fig. 5). After helix formation in the endoplasmic reticulum, newly formed procollagen molecules are secreted into the extracellular space, where their N and C-propeptides are cleaved at specific sites by procollagen N-proteinase and C-proteinase, respectively. The loss of the N-telopeptide and consequently of the N-proteinase cleavage site leads to union of the N-propeptide to the main triple-helical domain of the molecule. This explains why, despite the absence of the N-telopeptide, the protein in type-VII disease is larger than normal, as shown by the slower migrating pN 2(I) chains extracted from the dermis of one of our patients (Case 2) and obtained from cultured dermal fibroblasts from both patients (Fig. 3).
The loss of the exon 6-encoded N-telopeptide has additional consequences. Dermal collagen from patients with type-VII Ehlers-Danlos syndrome has been shown to be three to fourfold more extractable14,22,33,45 and to contain fewer, and abnormal, ß-dimeric cross-linked -chains of type-I collagen9,14,33. These findings are consistent with defective cross-linking and the formation of abnormal fibrillar collagen structures. Indeed, collagen extracted from bone and soft tissue contained more pN 2(I) chains than 2(I) chains, indicating basic differences in the chemistry and molecular sites of their cross-links14. The abnormal ß-dimers found in pepsin extracts were believed to be the result of intermolecular cross-linking involving secondary lysyl residues other than the critical cross-linking lysine at position 9 of the telopeptide that was deleted. Chiodo et al.8 described a patient (Case 5 in Table I) in whom the critical cross-linking lysyl residue was not deleted. Nevertheless, collagen solubility was increased in this patient, as well as in her affected son, and extraction profiles of the mutant type-I collagen were abnormal, indicating that dermal collagen cross-linking was abnormal despite the presence of the lysyl residue. On the basis of the published data, it is still unclear if the pathogenesis of the disease is related to the persistence of the N-propeptide or the loss of the lysine 9 cross-linking residue. Indeed, in one patient (Case 15), native mutant collagen molecules were shown to retain, in vivo and in vitro, both cleaved N-telopeptides of the pro 1(I) chains because of triple-helical binding to the mutant pN 2(I) chain46 (Table I).
Rotary shadowing of pepsin-digested collagen produced in vitro by cultured fibroblasts showed that one-half of the molecules were kinked at the N-terminal and were longer than normal (Fig. 5). Furthermore, electron microscopy of dermal collagens showed that the collagen fibrils of patients who had type-VII Ehlers-Danlos syndrome were loosely and randomly organized. These fibrils have smaller diameters than normal fibrils, and cross sections of these fibrils demonstrate irregular, ragged outlines14,36. These near-circular cross-sectional fibrils are different from the hieroglyphic fibrils seen in dermatosparactic animals and in humans who have type-VIIC disease as a result of N-proteinase deficiency40. Watson et al.40 proposed a model of fibril formation in type-VIIC disease in which the intact N-propeptides are located at the surface of the hieroglyphic fibrils. Partial cleavage of the in vitro synthesized abnormal collagen by N-proteinase allowed the N-propeptide to be incorporated within the body of the fibrils with conversion of the hieroglyphic outlines, which are characteristic of type-VIIC disease, to ragged outlines, which are characteristic of type-VIIA and VIIB disease.
In the present study, most patients who had type-VIIA or VIIB Ehlers-Danlos syndrome had heterozygous new mutations (Table I). In the small number of families that had multiple affected members, the disease was inherited as an autosomal dominant trait. Variability within the families was small; however, in the family of one patient (Case 12), the mild expression in the mother and the severe expression in the four children (all five of whom had type-VIIB disease) may indicate that the mother was mildly symptomatic secondary to a mosaic mutation of the COL1A2 gene39.
We found that the homogeneous nature of the molecular defects makes it possible, in centers with appropriate facilities and expertise, to establish the molecular diagnosis rapidly. Once the diagnosis has been established, the clinical problems, particularly those related to dislocation of the hip, can be predicted. Adequate physical and occupational therapy and orthotic treatment can then be provided to assist with standing, walking, and activities of daily living. Appropriate operative treatment of the dislocated hips should decrease the frequency of persistent and recurrent dislocations, avascular necrosis, and early osteoarthritis. However, more experience with and knowledge about the clinical features and molecular defects are necessary before accurate correlations can be drawn between genotype and phenotype and before recommendations can be made about the treatment of musculoskeletal problems.
 |
Footnotes
|
|---|
*No benefits in any form have been received or will be received from a commercial party related directly or indirectly to the subject of this article. Funds were received in total or partial support of the research or clinical study presented in this article. The funding sources were grants from the Swiss National Foundation (B. S.) (Grant Number 32-42198-94) and from the Medical Research Council of Canada and the Samuel Lunenfeld Foundation (W. G. C.).
Department of Metabolic and Molecular Diseases, University Children's Hospital, Zurich University, Steinwiesstrasse 75, 8032 Zurich, Switzerland. E-mail address for Dr. Steinmann: binges@kispi.unizh.ch.
Institute of Human Genetics, Im Neuenheimer Feld 328 69120 Heidelberg, Germany.
§Division of Orthopaedics, The Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada.
 |
References
|
|---|
-
Bachmann, B.; Luke, W.; and and Hunsmann, G.: Improvement of PCR amplified DNA sequencing with the aid of detergents. Nucl. Acids Res., 18: 1309, 1990.[Free Full Text]
-
Bateman, J. F., and and Golub, S. B.: Assessment of procollagen processing defects by fibroblasts cultured in the presence of dextran sulphate. Biochem. J., 267: 573-577, 1990.[Medline]
-
Beighton, P.; De Paepe, A.; Steinmann, B.; Tsipouras, P.; and and Wenstrup, R. J.: Ehlers-Danlos syndromes: revised nosology, Villefranche, 1997. Ehlers-Danlos National Foundation (USA) and Ehlers-Danlos Support Group (UK). Am. J. Med. Genet., 77: 31-37, 1998.[Medline]
-
Bennet, G. C.; Rang, M.; Roye, D. P.; and and Aprin, H.: Dislocation of the hip in trisomy 21. J. Bone and Joint Surg., 64-B(3): 289-294, 1982.[Free Full Text]
-
Bruckner, P., and and Prockop, D. J.: Proteolytic enzymes as probes for the triple-helical conformation of procollagen. Analyt. Biochem., 110: 360-368, 1981.
-
Byers, P. H.; Duvic, M.; Atkinson, M.; Robinow, M.; Smith, L. T.; Krane, S. M.; Greally, M. T.; Ludman, M.; Matalon, R.; Pauker, S.; Quanbeck, D.; and and Schwarze, U.: Ehlers-Danlos syndrome type VIIA and VIIB result from splice-junction mutations or genomic deletions that involve exon 6 in the COL1A1 and COL1A2 genes of type I collagen. Am. J. Med. Genet., 72: 94-105, 1997.[Medline]
-
Carr, A. J.; Chiodo, A. A.; Hilton, J. M.; Chow, C. W.; Hockey, A.; and and Cole, W. G.: The clinical features of Ehlers-Danlos syndrome type VIIB resulting from a base substitution at the splice acceptor site of intron 5 of the COL1A2 gene. J. Med. Genet., 31: 306-311, 1994.[Abstract/Free Full Text]
-
Chiodo, A. A.; Hockey, A.; and and Cole, W. G.: A base substitution at the splice acceptor site of intron 5 of the COL1A2 gene activates a cryptic splice site within exon 6 and generates abnormal type I procollagen in a patient with Ehlers-Danlos syndrome type VII. J. Biol. Chem., 267: 6361-6369, 1992.[Abstract/Free Full Text]
-
Cole, W. G.; Chan, D.; Chambers, G. W.; Walker, I. D.; and and Bateman, J. F.: Deletion of 24 amino acids from the pro-alpha 1(I) chain of type I procollagen in a patient with the Ehlers-Danlos syndrome type VII. J. Biol. Chem., 261: 5496-5503, 1986.[Abstract/Free Full Text]
-
Cole, W. G.; Evans, R.; and and Sillence, D. O.: The clinical features of Ehlers-Danlos syndrome type VII due to a deletion of 24 amino acids from the pro alpha 1(I) chain of type I procollagen. J. Med. Genet., 24: 698-701, 1987.[Abstract/Free Full Text]
-
D'Alessio, M.; Ramirez, F.; Blumberg, B. D.; Wirtz, M. K.; Rao, V. H.; Godfrey, M. D.; and and Hollister, D. W.: Characterization of a COL1A1 splicing defect in a case of Ehlers-Danlos syndrome type VII: evidence of molecular homogeneity. Am. J. Hum. Genet., 49: 400-406, 1991.[Medline]
-
de Wet, W.; Bernard, M.; Benson-Chanda, V.; Chu, M. L.; Dickson, L.; Weil, D.; and and Ramirez, F.: Organization of the human pro-alpha 2(I) collagen gene. J. Biol. Chem., 262: 16032-16036, 1987.[Abstract/Free Full Text]
-
Dietz, F. R., and and Mathews, K. D.: Current concepts review. Update on the genetic bases of disorders with orthopaedic manifestations. J. Bone and Joint Surg., 78-A: 1583-1598, Oct. 1996.[Free Full Text]
-
Eyre, D. R.; Shapiro, F. D.; and and Aldridge, J. F.: A heterozygous collagen defect in a variant of the Ehlers-Danlos syndrome type VII. Evidence for a deleted amino-telopeptide domain in the pro-alpha 2(I) chain. J. Biol. Chem., 260: 11322-11329, 1985.[Abstract/Free Full Text]
-
Halila, R.; Steinmann, B.; and and Peltonen, L.: Processing of type I and III procollagen in Ehlers-Danlos syndrome type VII. Am. J. Hum. Genet., 39: 222-231, 1986.[Medline]
-
Hass, J., and and Hass, R.: Arthrochalasis multiplex congenita. J. Bone and Joint Surg., 40-A: 663-674, June 1958.[Abstract/Free Full Text]
-
Ho, K. K.; Kong, R. Y.; Kuffner, T.; Hsu, L. H.; Ma, L.; and and Cheah, K. S.: Further evidence that the failure to cleave the aminopropeptide of type I procollagen is the cause of Ehlers-Danlos syndrome type VII. Hum. Mutat., 3: 358-364, 1994.[Medline]
-
Holmes, D. F.; Watson, R. B.; Steinmann, B.; and and Kadler, K. E.: Ehlers-Danlos syndrome type VIIB. Morphology of type I collagen fibrils formed in vivo and in vitro is determined by the conformation of the retained N-propeptide. J. Biol. Chem., 268: 15758-15765, 1993.[Abstract/Free Full Text]
-
Kuivaniemi, H.; Tromp, G.; Chu, M. L.; and and Prockop, D. J.: Structure of a full-length c-DNA clone for the prepro-alpha 2(I) chain of human type I procollagen. Comparison with the chicken gene confirms unusual patterns of gene conservation. Biochem. J., 252: 633-640, 1988.[Medline]
-
Lehmann, H. W.; Mundlos, S.; Winterpacht, A.; Brenner, R. E.; Zabel, B.; and and Muller, P. K.: Ehlers-Danlos syndrome type VII: phenotype and genotype. Arch. Dermatolog. Res., 286: 425-428, 1994.
-
Lichtenstein, J. R.; Kohn, L. D.; Martin, G. R.; Byers, P.; and and McKusick, V. A.: Procollagen peptidase deficiency in a form of the Ehlers-Danlos syndrome. Trans. Assn. Am. Phys., 86: 333-339, 1973.[Medline]
-
Lichtenstein, J. R.; Martin, G. R.; Kohn, L. D.; Byers, P. H.; and and McKusick, V. A.: Defect in conversion of procollagen to collagen in a form of Ehlers-Danlos syndrome. Science, 182: 298-300, 1973.[Abstract/Free Full Text]
-
McMaster, M. J.: Spinal deformity in Ehlers-Danlos syndrome. Five patients treated by spinal fusion. J. Bone and Joint Surg., 76-B(5): 773-777, 1994.
-
Minor, R. R.; Sippola-Thiele, M.; McKeon, J.; Berger, J.; and and Prockop, D. J.: Defects in the processing of procollagen to collagen are demonstrable in cultured fibroblasts from patients with the Ehlers-Danlos and osteogenesis imperfecta syndromes. J. Biol. Chem., 261: 10006-10014, 1986.[Abstract/Free Full Text]
-
Nicholls, A. C.; Oliver, J.; Renouf, D. V.; McPheat, J.; Palan, A.; and and Pope, F. M.: Ehlers-Danlos syndrome type VII: a single base change that causes exon skipping in the type I collagen alpha 2(I) chain. Hum. Genet., 87: 193-198, 1991.[Medline]
-
Nusgens, B. V.; Verellen-Dumoulin, C.; Hermanns-Le, T.; De Paepe, A.; Nuytinck, L.; Pierard, G. E.; and and Lapiere, C. M.: Evidence for a relationship between Ehlers-Danlos type VII C in humans and bovine dermatosparaxis. Nature Genet., 1: 214-217, 1992.[Medline]
-
Pope, F. M.; Nicholls, A. C.; Palan, A.; Kwee, M. L.; De Groot, W. P.; and and Hausmann, R.: Clinical features of an affected father and daughter with Ehlers-Danlos syndrome type VIIB. British J. Dermatol., 126: 77-82, 1992.[Medline]
-
Raghunath, M.; Steinmann, B.; Delozier-Blanchet, C.; Extermann, P.; and and Superti-Furga, A.: Prenatal diagnosis of collagen disorders by direct biochemical analysis of chorionic villus biopsies. Pediat. Res., 36: 441-448, 1994.[Medline]
-
Sambrook, J.; Fritsch, E. F.; and Maniatis, T.: Molecular Cloning: A Laboratory Manual. Ed. 2. Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press, 1989.
-
Smith, L. T.; Wertelecki, W.; Milstone, L. M.; Petty, E. M.; Seashore, M. R.; Braverman, I. M.; Jenkins, T. G.; and and Byers, P. H.: Human dermatosparaxis: a form of Ehlers-Danlos syndrome that results from failure to remove the amino-terminal propeptide of type I procollagen. Am. J. Hum. Genet., 51: 235-244, 1992.[Medline]
-
Steel, H. H., and and Kohl, E. J.: Multiple congenital dislocations associated with other skeletal anomalies (Larsen's syndrome) in three siblings. J. Bone and Joint Surg., 54-A: 75-82, Jan. 1972.[Abstract/Free Full Text]
-
Steinmann, B.; Tuderman, L.; Martin, G. R.; and and Prockop, D. J.: Evidence for a structural mutation of procollagen in a patient with Ehlers-Danlos syndrome type VII [abstract]. European J. Pediat., 130: 203, 1979.
-
Steinmann, B.; Tuderman, L.; Peltonen, L.; Martin, G. R.; McKusick, V. A.; and and Prockop, D. J.: Evidence for a structural mutation of procollagen type I in a patient with the Ehlers-Danlos syndrome type VII. J. Biol. Chem., 255: 8887-8893, 1980.[Abstract/Free Full Text]
-
Steinmann, B.; Rao, V. H.; Vogel, A.; Bruckner, P.; Gitzelmann, R.; and and Byers, P. H.: Cysteine in the triple-helical domain of one allelic product of the alpha 1(I) gene of type I collagen produces a lethal form of osteogenesis imperfecta. J. Biol. Chem., 259: 11129-11138, 1984.[Abstract/Free Full Text]
-
Steinmann, B.; Rao, V. H.; and and Gitzelmann, R.: A structurally abnormal
2(I) collagen chain in a further patient with Ehlers-Danlos syndrome type VII. Ann. New York Acad. Sci., 460: 506-509, 1985.
-
Steinmann, B.; Royce, P. M.; and Superti-Furga, A.: The Ehlers-Danlos syndrome. In Connective Tissue and Its Heritable Disorders: Molecular, Genetic, and Medical Aspects, pp. 351-407. Edited by P. M. Royce and B. Steinmann. New York, Wiley-Liss, 1993.
-
Strobel, D.; Tsuneyoshi, T.; Kuivaniemi, H.; Tromp, G.; Spotila, L. D.; Baldwin, C. T.; Constantinou, C. D.; Ganguly, A.; Sereda, L.; Sokolov, B. P.; and and Prockop, D. J.: Three new polymorphisms at the COL1A2 locus. Matrix, 12: 87-91, 1992.[Medline]
-
Vasan, N. S.; Kuivaniemi, H.; Vogel, B. E.; Minor, R. R.; Wootton, J. A.; Tromp, G.; Weksberg, R.; and and Prockop, D. J.: A mutation in the pro alpha 2(I) gene (COL1A2) for type I procollagen in Ehlers-Danlos syndrome type VII: evidence suggesting that skipping of exon 6 in RNA splicing may be a common cause of the phenotype. Am. J. Hum. Genet., 48: 305-317, 1991.[Medline]
-
Viljoen, D.; Goldblatt, J.; Thompson, D.; and and Beighton, P.: Ehlers-Danlos syndrome: yet another type?. Clin. Genet., 32: 196-201, 1987.[Medline]
-
Watson, R. B.; Wallis, G. A.; Holmes, D. F.; Viljoen, D.; Byers, P. H.; and and Kadler, K. E.: Ehlers Danlos syndrome type VIIB. Incomplete cleavage of abnormal type I procollagen by N-proteinase in vitro results in the formation of copolymers of collagen and partially cleaved pNcollagen that are near circular in cross-section. J. Biol. Chem., 267: 9093-9100, 1992.[Abstract/Free Full Text]
-
Weil, D.; Bernard, M.; Combates, N.; Wirtz, M. K.; Hollister, D. W.; Steinmann, B.; and and Ramirez, F.: Identification of a mutation that causes exon skipping during collagen pre-mRNA splicing in an Ehlers-Danlos syndrome variant. J. Biol. Chem., 263: 8561-8564, 1988.[Abstract/Free Full Text]
-
Weil, D.; D'Alessio, M.; Ramirez, F.; de Wet, W.; Cole, W. G.; Chan, D.; and and Bateman, J. F.: A base substitution in the exon of a collagen gene causes alternative splicing and generates a structurally abnormal polypeptide in a patient with Ehlers-Danlos syndrome type VII. EMBO J., 8: 1705-1710, 1989.[Medline]
-
Weil, D.; D'Alessio, M.; Ramirez, F.; Steinmann, B.; Wirtz, M. K.; Glanville, R. W.; and and Hollister, D. W.: Temperature-dependent expression of a collagen splicing defect in the fibroblasts of a patient with Ehlers-Danlos syndrome type VII. J. Biol. Chem., 264: 16804-16809, 1989.[Abstract/Free Full Text]
-
Weil, D.; D'Alessio, M.; Ramirez, F.; and and Eyre, D. R.: Structural and functional characterization of a splicing mutation in the pro-alpha 2(I) collagen gene of an Ehlers-Danlos type VII patient. J. Biol. Chem., 265: 16007-16011, 1990.[Abstract/Free Full Text]
-
Wirtz, M. K.; Glanville, R. W.; Steinmann, B.; Rao, V. H.; and and Hollister, D. W.: Ehlers-Danlos syndrome type VIIB. Deletion of 18 amino acids comprising the N-telopeptide region of a pro-alpha 2(I) chain. J. Biol. Chem., 262: 16376-16385, 1987.[Abstract/Free Full Text]
-
Wirtz, M. K.; Keene, D. R.; Hori, H.; Glanville, R. W.; Steinmann, B.; Rao, V. H.; and and Hollister, D. W.: In vivo and in vitro noncovalent association of excised alpha 1(I) amino-terminal propeptides with mutant pN alpha 2(I) collagen chains in native mutant collagen in a case of Ehlers-Danlos syndrome, type VII. J. Biol. Chem., 265: 6312-6317, 1990.[Abstract/Free Full Text]

CiteULike Connotea Del.icio.us Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
F. Malfait, A. J. Hakim, A. De Paepe, and R. Grahame
The genetic basis of the joint hypermobility syndromes
Rheumatology,
May 1, 2006;
45(5):
502 - 507.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. A. Cabral, E. Makareeva, A. Colige, A. D. Letocha, J. M. Ty, H. N. Yeowell, G. Pals, S. Leikin, and J. C. Marini
Mutations Near Amino End of {alpha}1(I) Collagen Cause Combined Osteogenesis Imperfecta/Ehlers-Danlos Syndrome by Interference with N-propeptide Processing
J. Biol. Chem.,
May 13, 2005;
280(19):
19259 - 19269.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. H. H. Engelbert, R. A. Bank, R. J. B. Sakkers, P. J. M. Helders, F. A. Beemer, and C. S. P. M. Uiterwaal
Pediatric Generalized Joint Hypermobility With and Without Musculoskeletal Complaints: A Localized or Systemic Disorder?
Pediatrics,
March 1, 2003;
111(3):
e248 - 254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. H. Byers
An Exception to the Rule
N. Engl. J. Med.,
October 18, 2001;
345(16):
1203 - 1205.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A C NICHOLLS, J L SHER, M J WRIGHT, C OLEY, R F MUELLER, and F M POPE
Clinical phenotypes and molecular characterisation of three patients with Ehlers-Danlos syndrome type VII
J. Med. Genet.,
November 1, 2000;
37(11):
33e - 33.
[Full Text]
|
 |
|
|